View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11325_high_3 (Length: 420)

Name: NF11325_high_3
Description: NF11325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11325_high_3
NF11325_high_3
[»] chr2 (1 HSPs)
chr2 (1-411)||(470161-470571)
[»] chr1 (2 HSPs)
chr1 (281-348)||(28042170-28042237)
chr1 (272-348)||(14250330-14250406)
[»] chr4 (1 HSPs)
chr4 (266-315)||(44960602-44960651)
[»] chr7 (1 HSPs)
chr7 (229-315)||(9484840-9484926)


Alignment Details
Target: chr2 (Bit Score: 395; Significance: 0; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 395; E-Value: 0
Query Start/End: Original strand, 1 - 411
Target Start/End: Complemental strand, 470571 - 470161
Alignment:
Q  1 ttctgcttctgcttctgcttctgcacccactcaacaccttattgatgcttctctcgcaattgccaccagatctgaacctcctcttccagatgtatccaac 100  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  470571 ttctgcttctgcttctgcttctgcacccactcaacacctcattgatgcttctctcgcaattgccaccagatctgaacctcctcttccagatgtatccaac 470472  T
Q  101 aaccaaattcaaccattttcttcaacttcaaccaccgtcaccgcggttgcaaatcctccaaaacgatccaccaaggacaggcacacaaaagttgatggcc 200  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
T  470471 aaccaaattcaaccattttcttcaacttcaaccaccgtcaccgctgttgcaaatcctccaaaacgatccaccaaggacaggcacacaaaagttgatggtc 470372  T
Q  201 gtggccggagaattcgaatgccggcgacatgtgcagcaagagttttccagttgaccagagaattaggccacaaatcagatggtgaaacaattgagtggct 300  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  470371 gtggacggagaattcgaatgccggcgacatgtgcagcaagagttttccagttgaccagagaattaggccacaaatcagatggtgaaacaattgagtggct 470272  T
Q  301 tcttcaacaagctgagccggcgatcattgccgctaccggtaccggaacaatcccagccaatttctcaacgctcaatgtctcactccgtagcagcggctct 400  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  470271 tcttcaacaagctgagccggcgatcattgccgctaccggtaccggaacaatcccagccaatttctcaacgctcaatgtctcactccgtagcagcggctct 470172  T
Q  401 acactctctgc 411  Q
    |||||||||||    
T  470171 acactctctgc 470161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 281 - 348
Target Start/End: Original strand, 28042170 - 28042237
Alignment:
Q  281 ggtgaaacaattgagtggcttcttcaacaagctgagccggcgatcattgccgctaccggtaccggaac 348  Q
    ||||||||||| |||||||||||||  || ||||||||| ||||||| |||||||| |||||||||||    
T  28042170 ggtgaaacaatcgagtggcttcttcgtcatgctgagccgtcgatcatcgccgctacaggtaccggaac 28042237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 272 - 348
Target Start/End: Complemental strand, 14250406 - 14250330
Alignment:
Q  272 aaatcagatggtgaaacaattgagtggcttcttcaacaagctgagccggcgatcattgccgctaccggtaccggaac 348  Q
    ||||| || ||| |||| ||||| |||||||| |  |||||||| ||| ||||||| ||||| ||||||||||||||    
T  14250406 aaatccgacggtcaaactattgaatggcttctccgtcaagctgaaccgtcgatcatcgccgccaccggtaccggaac 14250330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 266 - 315
Target Start/End: Complemental strand, 44960651 - 44960602
Alignment:
Q  266 ggccacaaatcagatggtgaaacaattgagtggcttcttcaacaagctga 315  Q
    ||||| ||||| ||||||||||| ||||| ||||||||||||||||||||    
T  44960651 ggccataaatctgatggtgaaaccattgaatggcttcttcaacaagctga 44960602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 229 - 315
Target Start/End: Complemental strand, 9484926 - 9484840
Alignment:
Q  229 atgtgcagcaagagttttccagttgaccagagaattaggccacaaatcagatggtgaaacaattgagtggcttcttcaacaagctga 315  Q
    ||||||||||||| | || ||| | || ||||| ||||| || ||||||||||||||||||||| | |||||| | |||||| ||||    
T  9484926 atgtgcagcaagaatctttcagctaacaagagagttaggtcataaatcagatggtgaaacaattcaatggcttttacaacaatctga 9484840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University