View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11324A_low_450 (Length: 220)

Name: NF11324A_low_450
Description: NF11324A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11324A_low_450
NF11324A_low_450
[»] chr1 (1 HSPs)
chr1 (22-208)||(46844530-46844716)
[»] scaffold0057 (1 HSPs)
scaffold0057 (154-198)||(48942-48986)


Alignment Details
Target: chr1 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 22 - 208
Target Start/End: Original strand, 46844530 - 46844716
Alignment:
Q  22 ccgtgtctgtcttattacatcaaaggaaagtatgatttgctaatttgtgtccgattagaattagaacgattccttgaaggaatgatagtgaataccatga 121  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  46844530 ccgtgtctgtcttattacatcaaaggaaagtataatttgctaatttgtgtccgattagaattagaccgattccttgaaggaatgatagtgaataccatga 46844629  T
Q  122 gatcttgaacctagttgcattattgcattgcaggggtgagatggcattttgcagccatgaatgccgtgaccagaggatattcttgga 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||    
T  46844630 gatcttgaacctagttgcattattgcattgcaggggtgagatggcattttgcagccatgaatgccgtgaccagaggatgttgttgga 46844716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0057
Description:

Target: scaffold0057; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 198
Target Start/End: Complemental strand, 48986 - 48942
Alignment:
Q  154 ggggtgagatggcattttgcagccatgaatgccgtgaccagagga 198  Q
    ||||||||||||||||||||| || |||||||||| |||||||||    
T  48986 ggggtgagatggcattttgcaaccctgaatgccgtaaccagagga 48942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University