View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11311_low_6 (Length: 365)

Name: NF11311_low_6
Description: NF11311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11311_low_6
NF11311_low_6
[»] chr1 (2 HSPs)
chr1 (19-249)||(6495631-6495861)
chr1 (284-359)||(6495896-6495971)


Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 249
Target Start/End: Original strand, 6495631 - 6495861
Alignment:
Q  19 gcagccagtgttggccttctgtttttgggagctgttgtgtgctattggtggggcagcagcgctgctgggtcgtctgggttgagttctgctggctggctgt 118  Q
    |||||||| ||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  6495631 gcagccagcgttggccttctgtttttgggagcttctgtgtgctattggtggggcagcagcgctgctgggtcgtctgggttgagttatgctggctggctgt 6495730  T
Q  119 gtgggcgtggaggttcttgcttgtgggaggcttgcaagtgttttgttccttttgctgtctgatttttggcagtcgtgttgctgctactgtgatgcagcct 218  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||    
T  6495731 gtgggcgtggatgttcttgcttgtgggaggcttgcaagtgttttgttccttttgctgtctgattgttggcagtcgtgttgctgttactgtgatgcagcct 6495830  T
Q  219 gcgcttttggcctgtagctgttacatattca 249  Q
    || ||||||||||||||||||||||| ||||    
T  6495831 gcacttttggcctgtagctgttacattttca 6495861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 284 - 359
Target Start/End: Original strand, 6495896 - 6495971
Alignment:
Q  284 agtcctctccgtgttggatttggactcttaggggttttttgatcgagtttgtttgtagtagtgtgctgcggtctgt 359  Q
    |||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||    
T  6495896 agtcctctccgtgttggatttggactcttagggggttttttatcgagtttgtttgtagtagtgtgctgcggtctgt 6495971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University