View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1130_low_33 (Length: 275)

Name: NF1130_low_33
Description: NF1130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1130_low_33
NF1130_low_33
[»] chr1 (2 HSPs)
chr1 (52-176)||(34882840-34882977)
chr1 (170-242)||(34882727-34882799)


Alignment Details
Target: chr1 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 52 - 176
Target Start/End: Complemental strand, 34882977 - 34882840
Alignment:
Q  52 catatttcatgtaatgaaaatgtagtcaatgattgtcgtttat------------gtaacacatgagcctattttatgtaacacataaatatgtact-at 138  Q
    |||||||||||||||||||||||||| ||||||||||||||||            |||||||||||||||||||||||||||||||||||||||| | ||    
T  34882977 catatttcatgtaatgaaaatgtagttaatgattgtcgtttatctatatatttatgtaacacatgagcctattttatgtaacacataaatatgtagtcat 34882878  T
Q  139 tagttgttggttatcgatatcttcatgtaacacatgaa 176  Q
    ||||||||||||||||||||||||||||||||||||||    
T  34882877 tagttgttggttatcgatatcttcatgtaacacatgaa 34882840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 170 - 242
Target Start/End: Complemental strand, 34882799 - 34882727
Alignment:
Q  170 acatgaacatgtacttgttagtagttggttttttcaggcaattaattgttcattataaatcaaatttcattcg 242  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  34882799 acatgaacatgtacttgttagtagttggtttttttaggcaattaattgttcattataaatcaaatttcattcg 34882727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University