View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1130_low_21 (Length: 344)

Name: NF1130_low_21
Description: NF1130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1130_low_21
NF1130_low_21
[»] chr3 (1 HSPs)
chr3 (93-272)||(8371681-8371860)
[»] chr2 (1 HSPs)
chr2 (218-264)||(45047927-45047973)


Alignment Details
Target: chr3 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 93 - 272
Target Start/End: Complemental strand, 8371860 - 8371681
Alignment:
Q  93 aatgatgtttgtgtttaaaaataaattaacgtattaaaatggttctggaaaaagaaaagggtgggaatctgtgtttatttgtgtgggagagaatagaaga 192  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | |||||||||||    
T  8371860 aatgatgtttgtgtttaaaaataaattaacgtattaaaatggttctggaaaaagaaaggggtgggaatctgtgtttatttgtgtggaaaagaatagaaga 8371761  T
Q  193 gaatgagactggctgatgaatgctgatgatgatggaaacaagaaaggggtgaagaaataaaattgatggaatggggataa 272  Q
    ||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8371760 gaatgagaccggctgatgaatgatgatgatgatggaaacaagaaaggggtgaagaaataaaattgatggaatggggataa 8371681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 218 - 264
Target Start/End: Complemental strand, 45047973 - 45047927
Alignment:
Q  218 atgatgatggaaacaagaaaggggtgaagaaataaaattgatggaat 264  Q
    ||||||||| ||||||||||| ||||||| |||||||||||||||||    
T  45047973 atgatgatgaaaacaagaaagtggtgaaggaataaaattgatggaat 45047927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University