View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11309A_low_146 (Length: 280)

Name: NF11309A_low_146
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11309A_low_146
NF11309A_low_146
[»] chr3 (1 HSPs)
chr3 (9-280)||(54877391-54877663)
[»] chr8 (1 HSPs)
chr8 (72-104)||(18322943-18322975)


Alignment Details
Target: chr3 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 9 - 280
Target Start/End: Original strand, 54877391 - 54877663
Alignment:
Q  9 gaaatgaaacggttgttcatgattctccggtgtggcggaggttgaatcttcaagatggaggagtgcagacatattaacactccaacgctcaagtcaatat 108  Q
    |||||| |||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||    
T  54877391 gaaatggaacggttgttcatggttctccggtgtggcggaggttgaatcttcaaggtggaggagtgcagacatattaacactccaacgctcaagtcagtat 54877490  T
Q  109 ttgtggttatgtgcagaagtgtaccttgagggtg-cgttgaatcatccttatatagacgtagagagcgctaacggttcccgcaaagtggggcgcaatctt 207  Q
    || ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| ||||||||||||| ||||||| |||||||||||    
T  54877491 ttatggttatgtgcagaagtgtaccttgagggtgtcgttgaatcatccttatatagatgtagagagtgctaacggttcccacaaagtgtggcgcaatctt 54877590  T
Q  208 aggaggtcgttagagattacgtggacnnnnnnnatgtagtcaaggcgtactcatgggtggggatccggcaggg 280  Q
    || |||||||||||||||||||||||       ||| ||||||||| |||||||| | || |||||| |||||    
T  54877591 agaaggtcgttagagattacgtggacggtggatatggagtcaaggcatactcatgtgcggtgatccgacaggg 54877663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 104
Target Start/End: Original strand, 18322943 - 18322975
Alignment:
Q  72 tgcagacatattaacactccaacgctcaagtca 104  Q
    ||||||||| |||||||||||||||||||||||    
T  18322943 tgcagacatgttaacactccaacgctcaagtca 18322975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University