View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1129_low_60 (Length: 280)

Name: NF1129_low_60
Description: NF1129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1129_low_60
NF1129_low_60
[»] chr4 (1 HSPs)
chr4 (1-104)||(1114170-1114273)
[»] chr3 (1 HSPs)
chr3 (21-94)||(17377549-17377622)


Alignment Details
Target: chr4 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 1114273 - 1114170
Alignment:
Q  1 tgagttgcaaccttgttgaaagtttaagggctttttcaggggacaacccacatgagtttatgagacttaacaatgtaaaggtgccacctttatgttgatc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  1114273 tgagttgcaaccttgttgaaagtttaagggctttttcaggggacaacccacatgagtttatgagacttaacaatgtaaaggtgtcacctttatgttgatc 1114174  T
Q  101 tgtg 104  Q
    ||||    
T  1114173 tgtg 1114170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 21 - 94
Target Start/End: Original strand, 17377549 - 17377622
Alignment:
Q  21 agtttaagggctttttcaggggacaacccacatgagtttatgagacttaacaatgtaaaggtgccacctttatg 94  Q
    |||||||||||| |||||||||||||| ||||||| || |  ||  || ||| |||||||||| ||||||||||    
T  17377549 agtttaagggctgtttcaggggacaactcacatgaattaacaaggtttgacactgtaaaggtgtcacctttatg 17377622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University