View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11295_low_4 (Length: 220)

Name: NF11295_low_4
Description: NF11295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11295_low_4
NF11295_low_4
[»] chr1 (2 HSPs)
chr1 (116-205)||(42268171-42268260)
chr1 (18-51)||(42268323-42268356)


Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 116 - 205
Target Start/End: Complemental strand, 42268260 - 42268171
Alignment:
Q  116 actagtaggagaaataagcaaacattagatcgtgtggttgaaaatattaatttctaaattacttctcaaatttcatttctaaatattcat 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42268260 actagtaggagaaataagcaaacattagatcgtgtggttgaaaatattaatttctaaattacttctcaaatttcatttctaaatattcat 42268171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 42268356 - 42268323
Alignment:
Q  18 catactaaataaattacatcacaaatgattttct 51  Q
    ||||||||||||||||||||||||||||||||||    
T  42268356 catactaaataaattacatcacaaatgattttct 42268323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University