View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11293A_low_313 (Length: 203)

Name: NF11293A_low_313
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11293A_low_313
NF11293A_low_313
[»] chr8 (1 HSPs)
chr8 (83-203)||(2282150-2282270)


Alignment Details
Target: chr8 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 83 - 203
Target Start/End: Complemental strand, 2282270 - 2282150
Alignment:
Q  83 ctgacgcaattaactccttattctaagaatttgactcttatatgtaaacattattttggtgttaataattttgcagtatgtggtactagctccttgggtg 182  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2282270 ctgacgcaattaactccttattctaagaatttgactcttatatgtaaacattattttggtgttaataattttgcagtatgtggtactagctccttgggtg 2282171  T
Q  183 attcacagcacatattctttg 203  Q
    |||||||||||||||||||||    
T  2282170 attcacagcacatattctttg 2282150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University