View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11293A_low_168 (Length: 252)

Name: NF11293A_low_168
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11293A_low_168
NF11293A_low_168
[»] chr3 (1 HSPs)
chr3 (108-247)||(3645084-3645226)


Alignment Details
Target: chr3 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 108 - 247
Target Start/End: Original strand, 3645084 - 3645226
Alignment:
Q  108 ttataacatgattgttattgcattggggattatcgtagacgtgttttcaatacaaagctacactttgtaccttctattattcattgtgattggtgaaaac 207  Q
    ||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3645084 ttatatcatgattgttattgcattgggaattatcgtagacgtgttttcaatacaaagctacactttgtaccttctattattcattgtgattggtgaaaac 3645183  T
Q  208 gatctcataac---atgataatcgcaagtttgaagaagtactt 247  Q
    |||||||||||   |||||||||||||||||||||||||||||    
T  3645184 gatctcataacatgatgataatcgcaagtttgaagaagtactt 3645226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University