View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11293A_low_112 (Length: 290)

Name: NF11293A_low_112
Description: NF11293A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11293A_low_112
NF11293A_low_112
[»] chr2 (2 HSPs)
chr2 (1-159)||(31658583-31658741)
chr2 (261-290)||(31658529-31658558)


Alignment Details
Target: chr2 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 31658741 - 31658583
Alignment:
Q  1 atgtaactttgaattttgttttgattatttgagacatgccactatgctatcatcgattgaatcatttgaatttgagaatgtttatgaccagttaggattt 100  Q
    ||||||||||||| ||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31658741 atgtaactttgaagtttattttgattatttgagacgtgccactatgctatcatcgattgaatcatttgaatttgagaatgtttatgaccagttaggattt 31658642  T
Q  101 tgatggctatggatatgtttctgtctaagtgtaaatttattttcaaagtttggcattgg 159  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31658641 tgatggctatggatatgtttctgtctaagtgtaaatttattttcaaagtttggcattgg 31658583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 290
Target Start/End: Complemental strand, 31658558 - 31658529
Alignment:
Q  261 taatgggagatttatttgatcgtttaactt 290  Q
    ||||||||||||||||||||||||||||||    
T  31658558 taatgggagatttatttgatcgtttaactt 31658529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University