View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11280A_low_346 (Length: 219)

Name: NF11280A_low_346
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11280A_low_346
NF11280A_low_346
[»] chr3 (1 HSPs)
chr3 (15-198)||(46387978-46388161)


Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 15 - 198
Target Start/End: Original strand, 46387978 - 46388161
Alignment:
Q  15 tgagatgaacaaaacaaaaagtaacattttttcaacatccatagcagaaaaattggatgatacatgctagtttattgtaggcaacaaannnnnnnnacaa 114  Q
    ||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||        ||||    
T  46387978 tgagaagaacaaaacaaaaagtaacattttttcaacattcatagcagaaaaattggatgatacatgttagtttattgtaggcaacaaattttttttacaa 46388077  T
Q  115 ctaaaatttattggaagaacattaatgcaaagaagatgattgaaatggtttagagtgtagggaacgagactctgcaactgattt 198  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
T  46388078 ctaaaatttattggaagaacattaatgcgaagaagatgattgaaatggtttagagtgtggggaacgagactctgcaactgattt 46388161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University