View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11280A_low_320 (Length: 227)

Name: NF11280A_low_320
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11280A_low_320
NF11280A_low_320
[»] chr3 (1 HSPs)
chr3 (6-196)||(35574630-35574834)


Alignment Details
Target: chr3 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 6 - 196
Target Start/End: Original strand, 35574630 - 35574834
Alignment:
Q  6 aggttagagttaaggttgactgtgatctaacagtggatcagttaacggcgcaggcgaagattgttgacagggattgtagttatggattcgatcttggtta 105  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35574630 aggttagagttaaggttgactgtgatctaacagtggatcagttaacggcgcaggcgaagattgttgacagggattgtagttatggattcgatcttggtta 35574729  T
Q  106 tgaaaatcatt--------------atatgggattaaattaaattgtttagaaattataccggcannnnnnnnnagacaatagattttgcttgtttgtac 191  Q
    |||||||||||              |||||||||||||||||||||||||||||||||||||||          |||||||||||| |||||||||||||    
T  35574730 tgaaaatcattatttggatttagggatatgggattaaattaaattgtttagaaattataccggcttttttttttagacaatagattatgcttgtttgtac 35574829  T
Q  192 tttgt 196  Q
    |||||    
T  35574830 tttgt 35574834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University