View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11280A_low_317 (Length: 227)

Name: NF11280A_low_317
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11280A_low_317
NF11280A_low_317
[»] chr2 (1 HSPs)
chr2 (1-162)||(32899226-32899387)


Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 162
Target Start/End: Original strand, 32899226 - 32899387
Alignment:
Q  1 ggttttggtgtttacaagggtagttttggaattgtgttttgttatgtgttagggagccataggatgtacctatggtggatatttataatttattattata 100  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32899226 ggttttggtgtttccaagggtagttttggaattgtgttttgttatgtgttagggagccataggatgtacctatggtggatatttataatttattattata 32899325  T
Q  101 agcatgtgttatttagaagtgtttgaattctgtatttttaaattgactaaagtacgtctatg 162  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32899326 agcatgtgttatttagaagtgtttgaattctgtatttttaaattgactaaagtacgtctatg 32899387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University