View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11280A_low_261 (Length: 235)

Name: NF11280A_low_261
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11280A_low_261
NF11280A_low_261
[»] chr4 (1 HSPs)
chr4 (6-215)||(23863985-23864193)


Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 6 - 215
Target Start/End: Original strand, 23863985 - 23864193
Alignment:
Q  6 aactaccctataagcttattttatacgtccttaattaattattattataacggcattaccgttgatataaaactattagtatcgttgagtaatgaccctt 105  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23863985 aactaccctataagcttattttatacgtccttaattaagtattattataacggcattaccgttgatataaaactattagtatcgttgagtaatgaccctt 23864084  T
Q  106 gtnnnnnnntgaaacggggtcctagctaacttgtcacaatttaaattgggttctctcttttaataaagatttaggcctctttattgtttgcttgtaataa 205  Q
    ||       |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  23864085 gt-ggggggtgaaacggggtcctagctaacttgtcacaatttacattgggttctctcttttaataaatatttaggcctctttattgtttgcttgtaataa 23864183  T
Q  206 tacatctaaa 215  Q
    ||||||||||    
T  23864184 tacatctaaa 23864193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University