View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11280A_low_255 (Length: 238)

Name: NF11280A_low_255
Description: NF11280A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11280A_low_255
NF11280A_low_255
[»] chr8 (1 HSPs)
chr8 (20-220)||(43804658-43804858)


Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 20 - 220
Target Start/End: Original strand, 43804658 - 43804858
Alignment:
Q  20 cttagagagtggagggtggtgcatcaggaaaatgggcaggctgctcgtctacaacagcctgttcagaatggtcaaacatggcagggacacgtctatttct 119  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  43804658 cttagagagtggagggtggtgcatcaggaaaatggacaggctgctcgtctacaacagcctgttcagaatggtcaaacatggcagcgacacgtctatttct 43804757  T
Q  120 gagcagcacaattagattggaattgagatttgcgtaagggacgcatatgaaatatttatgggagaaaaactttgtgggtgcaacctatcttgtatgttaa 219  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
T  43804758 gagcagcacaattagattggaattgagatttgcttaagggacgcatatgaaatatttatgggagaaaaactttgtgggtgcaacctatcttgaatgttaa 43804857  T
Q  220 g 220  Q
    |    
T  43804858 g 43804858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University