View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11278_low_165 (Length: 227)

Name: NF11278_low_165
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11278_low_165
NF11278_low_165
[»] chr1 (3 HSPs)
chr1 (84-210)||(48045467-48045593)
chr1 (36-80)||(48044638-48044682)
chr1 (98-158)||(48056908-48056968)


Alignment Details
Target: chr1 (Bit Score: 119; Significance: 6e-61; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 84 - 210
Target Start/End: Original strand, 48045467 - 48045593
Alignment:
Q  84 acactacttgcatatttctgtcgggtcttgcttagacaaagtgtcaggtttgtcaattttattacctaaaaccagcaattgaatccaattttaagaaggt 183  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48045467 acactacttgcatatttctgtcgggtcttgcttagacaaattgtcaggtttgtcaattttattacctaaaaccagcaattgaatccaattttaagaaggt 48045566  T
Q  184 ttgctcaacaaattcatggagttccct 210  Q
    |||||||||||| ||||||||||||||    
T  48045567 ttgctcaacaaagtcatggagttccct 48045593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 36 - 80
Target Start/End: Original strand, 48044638 - 48044682
Alignment:
Q  36 tatggattgaatattatagaaccacaaatgcagatatattaatat 80  Q
    |||||||||||||||||||||||||||||||||| ||||||||||    
T  48044638 tatggattgaatattatagaaccacaaatgcagagatattaatat 48044682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 98 - 158
Target Start/End: Original strand, 48056908 - 48056968
Alignment:
Q  98 tttctgtcgggtcttgcttagacaaagtgtcaggtttgtcaattttattacctaaaaccag 158  Q
    ||||||||| |||||||||||||||||   ||||||||||||| |||||||| | ||||||    
T  48056908 tttctgtcgtgtcttgcttagacaaagcaccaggtttgtcaatcttattaccaagaaccag 48056968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University