View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11278_low_152 (Length: 240)

Name: NF11278_low_152
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11278_low_152
NF11278_low_152
[»] chr6 (2 HSPs)
chr6 (55-212)||(30507304-30507461)
chr6 (1-51)||(30506964-30507014)


Alignment Details
Target: chr6 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 55 - 212
Target Start/End: Original strand, 30507304 - 30507461
Alignment:
Q  55 atcataagctcaaactattgtctctataaatagtagatgaacaatatggattgttgcgactcaatttttatatccttgcgattacaaatttcaaatcatt 154  Q
    ||||||||||||||||||||||||| ||||||||| |||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  30507304 atcataagctcaaactattgtctctctaaatagtacatgaacaatatgaattgttgcgcctcaatttttatatccttgcgattacaaatttcaaatcatt 30507403  T
Q  155 tgcaattggggattctccatattaatgcaattatgacatcagtggtcgtttgatcaag 212  Q
    ||||||||||||||||| ||||||| ||||| ||||||||||||||| ||||||||||    
T  30507404 tgcaattggggattctctatattaacgcaatcatgacatcagtggtcatttgatcaag 30507461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 30506964 - 30507014
Alignment:
Q  1 ttaaaatggggcagcaagcccgtgcgtcacgccttggtcatgtacttgcat 51  Q
    |||||| ||||||||||||||||| ||||||||||||||||||||||||||    
T  30506964 ttaaaacggggcagcaagcccgtgtgtcacgccttggtcatgtacttgcat 30507014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University