View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11278_low_129 (Length: 251)

Name: NF11278_low_129
Description: NF11278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11278_low_129
NF11278_low_129
[»] chr1 (2 HSPs)
chr1 (19-243)||(14193064-14193294)
chr1 (147-205)||(18521891-18521949)
[»] chr4 (3 HSPs)
chr4 (160-242)||(4591407-4591489)
chr4 (157-242)||(4555103-4555188)
chr4 (155-213)||(4620934-4620992)


Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 19 - 243
Target Start/End: Original strand, 14193064 - 14193294
Alignment:
Q  19 cttctagctgctgggataatcatcattccagtac---gccaggtgcnnnnnnntccggaggtaattgatttgacggatacattcgactttaatataagtt 115  Q
    ||||||||||||||||||||||||||||||||||   ||| ||||        |||  ||||| |||||||||||||||||||||||||||||||| |||    
T  14193064 cttctagctgctgggataatcatcattccagtaccctgcctggtggaacgaaatccccaggtacttgatttgacggatacattcgactttaatatacgtt 14193163  T
Q  116 ttgacgataca---gggaagctaggaatcccggtgttgaatgtcaaggaaacaacggaagtgaggtggaggaatttgattgcttgggagcagagcaaaat 212  Q
    | ||| ||| |   ||| ||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14193164 tggactatataacgggggagctacgaatcccggtgttgaatttcaaggaaacaacggaagtgaggtggaggaatttgattgcttgggagcagagcaaaat 14193263  T
Q  213 taacattaaatgcaaatatacatcctatgct 243  Q
    |||||||| ||||||||||||||||||||||    
T  14193264 taacattagatgcaaatatacatcctatgct 14193294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 147 - 205
Target Start/End: Original strand, 18521891 - 18521949
Alignment:
Q  147 gttgaatgtcaaggaaacaacggaagtgaggtggaggaatttgattgcttgggagcaga 205  Q
    |||| |||| ||||||||||||||||||| |||||||||||||||||||||||| ||||    
T  18521891 gttgtatgttaaggaaacaacggaagtgaagtggaggaatttgattgcttgggaacaga 18521949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 160 - 242
Target Start/End: Original strand, 4591407 - 4591489
Alignment:
Q  160 gaaacaacggaagtgaggtggaggaatttgattgcttgggagcagagcaaaattaacattaaatgcaaatatacatcctatgc 242  Q
    |||||||||||||||| ||||||||||||||||||||||||||| ||||||| |   |||| ||||||||| |||||||||||    
T  4591407 gaaacaacggaagtgaagtggaggaatttgattgcttgggagcaaagcaaaaattggattagatgcaaatacacatcctatgc 4591489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 157 - 242
Target Start/End: Original strand, 4555103 - 4555188
Alignment:
Q  157 aaggaaacaacggaagtgaggtggaggaatttgattgcttgggagcagagcaaaattaacattaaatgcaaatatacatcctatgc 242  Q
    ||||||| ||||||||||| ||||||||||||||||||||||||||| |||||||||   | |||||||||||| || ||||||||    
T  4555103 aaggaaagaacggaagtgaagtggaggaatttgattgcttgggagcaaagcaaaatttggagtaaatgcaaatacacttcctatgc 4555188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 155 - 213
Target Start/End: Original strand, 4620934 - 4620992
Alignment:
Q  155 tcaaggaaacaacggaagtgaggtggaggaatttgattgcttgggagcagagcaaaatt 213  Q
    ||||||||||||| ||||| | ||||||||||||||||||||||||||| |||||||||    
T  4620934 tcaaggaaacaactgaagttaagtggaggaatttgattgcttgggagcaaagcaaaatt 4620992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University