View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1126_low_232 (Length: 201)

Name: NF1126_low_232
Description: NF1126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1126_low_232
NF1126_low_232
[»] chr5 (1 HSPs)
chr5 (68-201)||(43327178-43327317)


Alignment Details
Target: chr5 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 68 - 201
Target Start/End: Complemental strand, 43327317 - 43327178
Alignment:
Q  68 ggcagatgggatggaagaggacagtacaacaccagatttctttgccattgaatcatccatggagagtataatgccaaaccattttgaagagtttcttcaa 167  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43327317 ggcagatgggatggaagaggacagtacaacaccagatttctttgccattgaatcatccatggagagtataatgccaaaccattttgaagagtttcttcaa 43327218  T
Q  168 aatcaa------aatcttgatgatgtatgtttggtggtgg 201  Q
    ||||||      ||||||||||||||||||||||| ||||    
T  43327217 aatcaaaatcaaaatcttgatgatgtatgtttggttgtgg 43327178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University