View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11269_low_31 (Length: 250)

Name: NF11269_low_31
Description: NF11269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11269_low_31
NF11269_low_31
[»] chr6 (2 HSPs)
chr6 (132-250)||(3077684-3077802)
chr6 (17-69)||(3077829-3077881)
[»] chr2 (2 HSPs)
chr2 (17-118)||(44692724-44692825)
chr2 (18-52)||(15316226-15316260)
[»] chr4 (1 HSPs)
chr4 (17-103)||(34866382-34866468)
[»] chr8 (1 HSPs)
chr8 (19-63)||(14248764-14248808)


Alignment Details
Target: chr6 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 132 - 250
Target Start/End: Complemental strand, 3077802 - 3077684
Alignment:
Q  132 tgctttcttgtgcgttgtgtgaagtcgatacggaaaaatgaactcacctctttgtgcattgctcggtagcgagaggggtttggttggagttgtttaagtg 231  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||    
T  3077802 tgctttcttgtgcgttgtgtgaagtcgatacggaaaaatgaactcacctctctgtgcattgcttggtagcgagaggggtttggttggagttgtttaagtg 3077703  T
Q  232 ggttgattactcgtttatt 250  Q
    |||  ||||||||||||||    
T  3077702 ggtcaattactcgtttatt 3077684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 17 - 69
Target Start/End: Complemental strand, 3077881 - 3077829
Alignment:
Q  17 actttggaaaagtccggctccgtctaaggtggtggcactttcgtggagggttt 69  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3077881 actttggaaaagtccggctccgtctaaggtggtggcactttcgtggagggttt 3077829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 17 - 118
Target Start/End: Original strand, 44692724 - 44692825
Alignment:
Q  17 actttggaaaagtccggctccgtctaaggtggtggcactttcgtggagggttttgcttgatcgtatcccgacgcggtttaatcttagtaggaggaatgcc 116  Q
    |||||||||||| ||||||||||| || |||||||| ||||| ||||  ||||||||||||||||| ||||||||||  |||||| |||| |||||||||    
T  44692724 actttggaaaagcccggctccgtcaaaagtggtggccctttcttggaaagttttgcttgatcgtattccgacgcggtggaatcttcgtagaaggaatgcc 44692823  T
Q  117 ct 118  Q
    ||    
T  44692824 ct 44692825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 52
Target Start/End: Original strand, 15316226 - 15316260
Alignment:
Q  18 ctttggaaaagtccggctccgtctaaggtggtggc 52  Q
    ||||||||||||||||||||||||||||| |||||    
T  15316226 ctttggaaaagtccggctccgtctaaggttgtggc 15316260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 103
Target Start/End: Complemental strand, 34866468 - 34866382
Alignment:
Q  17 actttggaaaagtccggctccgtctaaggtggtggcactttcgtggagggttttgcttgatcgtatcccgacgcggtttaatcttag 103  Q
    |||||||||||| ||||| || || || |||||||| ||||| ||||  || |||||||||||||| ||| |||| || ||||||||    
T  34866468 actttggaaaagcccggccccctcaaaagtggtggccctttcttggaaagtcttgcttgatcgtattccgtcgcgattgaatcttag 34866382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 63
Target Start/End: Complemental strand, 14248808 - 14248764
Alignment:
Q  19 tttggaaaagtccggctccgtctaaggtggtggcactttcgtgga 63  Q
    ||||||| ||||||||||||||||||| |||||| ||||| ||||    
T  14248808 tttggaagagtccggctccgtctaaggcggtggctctttcttgga 14248764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University