View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11261_low_3 (Length: 472)

Name: NF11261_low_3
Description: NF11261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11261_low_3
NF11261_low_3
[»] chr7 (1 HSPs)
chr7 (342-472)||(35443263-35443393)
[»] chr5 (2 HSPs)
chr5 (63-193)||(29700693-29700823)
chr5 (70-181)||(29678240-29678351)


Alignment Details
Target: chr7 (Bit Score: 131; Significance: 9e-68; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 131; E-Value: 9e-68
Query Start/End: Original strand, 342 - 472
Target Start/End: Complemental strand, 35443393 - 35443263
Alignment:
Q  342 ctctaatatttgcgatacgtcaagtggatccgcaatgcatactcttattactcgtcaagatgttgaccaggtaattaattgacctctctctaatgatatg 441  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35443393 ctctaatatttgcgatacgtcaagtggatccgcaatgcatactcttattactcgtcaagatgttgaccaggtaattaattgacctctctctaatgatatg 35443294  T
Q  442 atacacttcactcattgttgatttagaatag 472  Q
    |||||||||||||||||||||||||||||||    
T  35443293 atacacttcactcattgttgatttagaatag 35443263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 115; Significance: 3e-58; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 63 - 193
Target Start/End: Original strand, 29700693 - 29700823
Alignment:
Q  63 aaagaacaaagaaaatgtctatgaatgagatgaacaagaaatcagaactcatcttcattcctgcaccaggaattggccacttagcttcagctcttgaatt 162  Q
    |||||||||||||||||||||||| ||| || |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29700693 aaagaacaaagaaaatgtctatgagtgatataaacaagaattcagaactcatcttcattcctgcaccaggaattggccacttagcttcagctcttgaatt 29700792  T
Q  163 tgcaaaacttttaaccaaccatgacaaaaat 193  Q
    |||||||||||||||||||||||||||||||    
T  29700793 tgcaaaacttttaaccaaccatgacaaaaat 29700823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 70 - 181
Target Start/End: Original strand, 29678240 - 29678351
Alignment:
Q  70 aaagaaaatgtctatgaatgagatgaacaagaaatcagaactcatcttcattcctgcaccaggaattggccacttagcttcagctcttgaatttgcaaaa 169  Q
    ||||||||||  | ||| ||||||| | |||||| ||||||| |||||||||||  ||||||  ||||||||||||| |||| | |||||||||||||||    
T  29678240 aaagaaaatggttgtgagtgagatggagaagaaagcagaacttatcttcattccctcaccagatattggccacttagtttcatcacttgaatttgcaaaa 29678339  T
Q  170 cttttaaccaac 181  Q
    || |||| ||||    
T  29678340 ctcttaatcaac 29678351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University