View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11260_low_33 (Length: 222)

Name: NF11260_low_33
Description: NF11260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11260_low_33
NF11260_low_33
[»] chr8 (1 HSPs)
chr8 (14-205)||(1973913-1974104)


Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 14 - 205
Target Start/End: Complemental strand, 1974104 - 1973913
Alignment:
Q  14 agatgaaggatgtggtattgaggaagcaaaagctatttgtgagccagaaatcattcgtcagctttttacttggcaggttgaaacatgttatcctacataa 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1974104 agatgaaggatgtggtattgaggaagcaaaagctatttgtgagccagaaatcattcgtcagctttttacttggcaggttgaaacatgttatcctacataa 1974005  T
Q  114 tcttttgtagtactttttagattcatagaggtgtaatttacaaacaatcgtatgtctctctctaactgctcaagctatttccgtgaacaatt 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1974004 tcttttgtagtactttttagattcatagaggtgtaatttacaaacaatcgtatgtctctctctaactgctcaagctatttccgtgaacaatt 1973913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University