View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1125_high_78 (Length: 242)

Name: NF1125_high_78
Description: NF1125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1125_high_78
NF1125_high_78
[»] chr2 (1 HSPs)
chr2 (145-234)||(33717547-33717636)


Alignment Details
Target: chr2 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 145 - 234
Target Start/End: Complemental strand, 33717636 - 33717547
Alignment:
Q  145 cacacaatgtaaacaaattataaaatgtaactaacatagactatttcaaagaatttacacatgttttgcacagaatcacaattagttcat 234  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33717636 cacaaaatgtaaacaaattataaaatgtaactaacatagactatttcaaagaatttacacatgttttgcacagaatcacaattagttcat 33717547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University