View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11259_high_6 (Length: 260)

Name: NF11259_high_6
Description: NF11259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11259_high_6
NF11259_high_6
[»] chr4 (1 HSPs)
chr4 (1-246)||(27694223-27694477)


Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 27694477 - 27694223
Alignment:
Q  1 ccaaactctaaaaatcttttgtccccaaaccgtgggcccaggcgggtttaaaaggataaaaaatgagtgatgaggcattattgg-------------ttg 87  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||             |||    
T  27694477 ccaaactctaaaaatcttttgtccctaaaccgtgggcccaggcgggtttaaaaggataaaaaatgagtgatgaggcattattgggcggttcatgtggttg 27694378  T
Q  88 acttgaagtcagcaccaagtgagataattagtccaggtagctagccatgactgactgactgagtcgagcagatcccccaaccaaccccaaaaaatcaaaa 187  Q
    |||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27694377 acttgaagtcagcaccaagtgagataattagtccaggtagc----catgactgactgactgagtcgagcagatcccccaaccaaccccaaaaaatcaaaa 27694282  T
Q  188 tggctatgatgtacggggtactacccattttcgctgccattttaatattgatctctgtg 246  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27694281 tggctatgatgtacggggtactacccattttcgctgccattttaatattgatctctgtg 27694223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University