View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1123_low_46 (Length: 204)

Name: NF1123_low_46
Description: NF1123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1123_low_46
NF1123_low_46
[»] chr8 (1 HSPs)
chr8 (1-125)||(39436568-39436692)


Alignment Details
Target: chr8 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 39436568 - 39436692
Alignment:
Q  1 tggtagttggggcatgaactcatctagttgtaaatatcgtgcatatgaaagataaaaagtgttccaaaagataatgaaaatgtaatcattttggcaaaat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39436568 tggtagttggggcatgaactcatctagttgtaaatatcgtgcatatgaaagataaaaagtgttccaaaagataatgaaaatgtaatcattttggcaaaat 39436667  T
Q  101 tttcagcttattaattaggcctatg 125  Q
    |||||||||||||||||||||||||    
T  39436668 tttcagcttattaattaggcctatg 39436692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University