View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1123_low_44 (Length: 234)

Name: NF1123_low_44
Description: NF1123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1123_low_44
NF1123_low_44
[»] chr5 (2 HSPs)
chr5 (1-136)||(15475048-15475183)
chr5 (1-133)||(15467497-15467629)


Alignment Details
Target: chr5 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 136
Target Start/End: Original strand, 15475048 - 15475183
Alignment:
Q  1 cgacggagatgtttggtgcagtgatggatttaacagtgtaatgggttgttgcaaatgttgttttgatgccttttgaaactaatctttttgagaattggat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15475048 cgacggagatgtttggtgcagtgatggatttaacagtgtaatgggttgttgcaaatgttgttttgatgccttttgaaactaatctttttgagaattggat 15475147  T
Q  101 tagtggactaatgtgtccttgtgctgggtatggaat 136  Q
    ||||||||||||||||||||||||||||||||||||    
T  15475148 tagtggactaatgtgtccttgtgctgggtatggaat 15475183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 15467497 - 15467629
Alignment:
Q  1 cgacggagatgtttggtgcagtgatggatttaacagtgtaatgggttgttgcaaatgttgttttgatgccttttgaaactaatctttttgagaattggat 100  Q
    ||||||| | ||||||||| || ||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |||| |||||||||||||||    
T  15467497 cgacggatacgtttggtgcggttatggattgaacagtgtaatgtgttgttgcaaatgttgttttgatgccttttgaaaccaatcgttttgagaattggat 15467596  T
Q  101 tagtggactaatgtgtccttgtgctgggtatgg 133  Q
    ||||||||||||||||||||||||||| |||||    
T  15467597 tagtggactaatgtgtccttgtgctggatatgg 15467629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University