View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1122_high_4 (Length: 208)

Name: NF1122_high_4
Description: NF1122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1122_high_4
NF1122_high_4
[»] chr7 (1 HSPs)
chr7 (18-162)||(39058162-39058306)


Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 18 - 162
Target Start/End: Complemental strand, 39058306 - 39058162
Alignment:
Q  18 catcatcttctttatatgatgtatcttctgttcttgtaaggagttactctccattgcttttgtcagtaaaattcaatggctaacaaacaacatacccctc 117  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39058306 catcctcttctttatatgatgtatcttctgttcttgtaaggagttactctccattgcttttgtcagtaaaattcaatggctaacaaacaacatacccctc 39058207  T
Q  118 ttagaataaatgaaatatttgtcaaacatgaataatagctacaac 162  Q
    ||||||||||||||||||||||||| |||||||||||||||||||    
T  39058206 ttagaataaatgaaatatttgtcaatcatgaataatagctacaac 39058162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University