View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11227_high_12 (Length: 279)

Name: NF11227_high_12
Description: NF11227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11227_high_12
NF11227_high_12
[»] chr3 (1 HSPs)
chr3 (14-265)||(46041946-46042197)
[»] chr5 (1 HSPs)
chr5 (211-266)||(27974198-27974253)


Alignment Details
Target: chr3 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 14 - 265
Target Start/End: Original strand, 46041946 - 46042197
Alignment:
Q  14 agactgacttcgaaaaaccttctttgggatacttggaggtttagggatgttgcgttgtttttctgtttggttattagggttaggaggtaatgaattagtt 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  46041946 agactgacttcgaaaaaccttctttgggatacttggaggtttagggatgttgcattgtttttctgtttggttattagggttaggaggtaatgaattagtt 46042045  T
Q  114 tcagggacactttcttcatcttcatcttcgtctattctataatggacttgttcaggaaaaacggtggcaattgtgcggttcgcgctttgtagctcctttg 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46042046 tcagggacactttcttcatcttcatcttcgtctattctataatggacttgttcaggaaaaacggtggcaattgtgcggttcgcgctttgtagctcctttg 46042145  T
Q  214 atagatgatcatatttctctgctaatgctctatatgctctaaaggcttcttc 265  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46042146 atagatgatcatatttctctgctaatgctctatatgctctaaaggcttcttc 46042197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 211 - 266
Target Start/End: Complemental strand, 27974253 - 27974198
Alignment:
Q  211 ttgatagatgatcatatttctctgctaatgctctatatgctctaaaggcttcttct 266  Q
    |||||| |||||||||| | || ||||| |||||||||||| ||||||||||||||    
T  27974253 ttgataaatgatcatatctttcggctaaggctctatatgctttaaaggcttcttct 27974198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University