View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11225_low_32 (Length: 212)

Name: NF11225_low_32
Description: NF11225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11225_low_32
NF11225_low_32
[»] chr5 (1 HSPs)
chr5 (12-165)||(14438559-14438713)


Alignment Details
Target: chr5 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 12 - 165
Target Start/End: Complemental strand, 14438713 - 14438559
Alignment:
Q  12 gagcacagacaatttttagggtatgagattttatatcagacgaaacagcgttgttttaggttaggtttaaatgagaaattgcaaaaaa-tttattattac 110  Q
    ||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||  |||||||||||| | |||||||||    
T  14438713 gagcacacacaatttttagggtatgagattttatatcagacgaagcagcgttgttttaggttaggtttaaatgatgaattgcaaaaaactgtattattac 14438614  T
Q  111 tgtatatattgaaggtggtaggaatagacataagtgtttggtaaaattaataatg 165  Q
    |||||| |||||||||||||||||||||||||||||||| |||||||||||||||    
T  14438613 tgtatagattgaaggtggtaggaatagacataagtgtttagtaaaattaataatg 14438559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University