View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11223_low_17 (Length: 203)

Name: NF11223_low_17
Description: NF11223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11223_low_17
NF11223_low_17
[»] chr7 (1 HSPs)
chr7 (20-183)||(7324058-7324221)
[»] chr6 (1 HSPs)
chr6 (96-176)||(27095631-27095711)


Alignment Details
Target: chr7 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 20 - 183
Target Start/End: Original strand, 7324058 - 7324221
Alignment:
Q  20 taactcgttctcagggtccactccatcacctccaaaatgatggaatattcgggtagccggcaggacatgttattgttgtttggtttgacacgattctgtc 119  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |||    
T  7324058 taactcgttctcagggtccactccatcacctcccaaatgatggaatattcggggagccggcaggacatgttattgttgtttggtttgacacaattccgtc 7324157  T
Q  120 ctttttgtccttaaatttctttagggatatgaattgctttcctaactatcgctttccctaggat 183  Q
    ||||||||| ||| ||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  7324158 ctttttgtctttagatttctttagggatatgaatttctttcctaactatcgctttccctaggat 7324221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 96 - 176
Target Start/End: Original strand, 27095631 - 27095711
Alignment:
Q  96 tgtttggtttgacacgattctgtcctttttgtccttaaatttctttagggatatgaattgctttcctaactatcgctttcc 176  Q
    ||||||||||||||| || | ||| |||||||| ||| ||||||| ||||| |||||| |||| ||||||||||| |||||    
T  27095631 tgtttggtttgacacaatgccgtcttttttgtctttagatttcttgagggacatgaatagcttgcctaactatcgttttcc 27095711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University