View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1121_high_34 (Length: 271)

Name: NF1121_high_34
Description: NF1121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1121_high_34
NF1121_high_34
[»] chr6 (1 HSPs)
chr6 (50-256)||(6219039-6219245)


Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 50 - 256
Target Start/End: Original strand, 6219039 - 6219245
Alignment:
Q  50 taagcttatcacacttcagctcacaatcctagggtttcttgaaaatttagggtgttacaactttcatatcccgtttggcataagaacaatgaattattaa 149  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||    
T  6219039 taagcttatcacacgtcagctcacaatcctagggtttcttgaaaatttagggtgttacaactttcatatcccttttggcatatgaacaatgaattattaa 6219138  T
Q  150 aagaactaatcggagaacttcgtaatgtcccttttggcatatagttagatataatgtgagttttgcatcgctgttatgaacatcaaccatcggaaaaata 249  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6219139 aagaactaatcggagaacttagtaatgtcccttttggcatatagttagatataatgtgagttttgcatcgctgttatgaacatcaaccatcggaaaaata 6219238  T
Q  250 ttattgg 256  Q
    || ||||    
T  6219239 ttgttgg 6219245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University