View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11218_high_37 (Length: 250)

Name: NF11218_high_37
Description: NF11218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11218_high_37
NF11218_high_37
[»] chr8 (1 HSPs)
chr8 (89-232)||(36982199-36982342)


Alignment Details
Target: chr8 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 89 - 232
Target Start/End: Original strand, 36982199 - 36982342
Alignment:
Q  89 atgggttaggacaggttgcaactttgacactaatggcaatggaaatgcctaactggtggttgtggaacaaacataaactgtacagtacctggaaatcctc 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36982199 atgggttaggacaggttgcaactttgacactaatggcaatggaaatgcctaactggtggttgtggaacaaacataaactgtacagtacctggaaatcctc 36982298  T
Q  189 ctgcaacaatttccgattttacccttggtgaacctgatttttat 232  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
T  36982299 ctgcaacaatttccgattttacccttggtgaacctgatttttat 36982342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University