View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11214_low_11 (Length: 320)

Name: NF11214_low_11
Description: NF11214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11214_low_11
NF11214_low_11
[»] chr8 (3 HSPs)
chr8 (73-310)||(9336584-9336821)
chr8 (20-68)||(9336545-9336593)
chr8 (172-242)||(8209356-8209426)
[»] chr1 (1 HSPs)
chr1 (172-257)||(42365183-42365268)


Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-112; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 73 - 310
Target Start/End: Original strand, 9336584 - 9336821
Alignment:
Q  73 cacagtctttttgagaaaatgacctaacagattcaaagttctaactccacccaaatcaccgttaaaagcaaaaaccctacctaccaaaaactgagacatt 172  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  9336584 cacagtctttttgagaaaatgacctaccagattcaaagttctaactccacccaaatcaccgttaaaagcaaaaaccctacctaccaaaaactgaaacatt 9336683  T
Q  173 aaccgaattcaaggatgcgaagatccttaggatcggtgatggatttacagatagaagccaaatcgatattcacttcacttcgcacctcccggttcgaatg 272  Q
    |||||||||||||||||||| | |||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||    
T  9336684 aaccgaattcaaggatgcgagggtccttaggatcgatgatggatttacagatagaagccaaatcgatattcgcttcacttcgcacctcccagttcgaatg 9336783  T
Q  273 aaaacgactatccttccattctgataacattattcttc 310  Q
    |||| |||||||||||||||||||||||||||||||||    
T  9336784 aaaaagactatccttccattctgataacattattcttc 9336821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 20 - 68
Target Start/End: Original strand, 9336545 - 9336593
Alignment:
Q  20 gggactgtgttggctttctcttcatgtgatattccttgtcacagtcttt 68  Q
    |||||||| |||||||||||||| |||||||||||||||||||||||||    
T  9336545 gggactgtcttggctttctcttcgtgtgatattccttgtcacagtcttt 9336593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 172 - 242
Target Start/End: Original strand, 8209356 - 8209426
Alignment:
Q  172 taaccgaattcaaggatgcgaagatccttaggatcggtgatggatttacagatagaagccaaatcgatatt 242  Q
    |||||||||| | | |||||| |||| ||||||||||||||||| | | ||| |||||| |||||||||||    
T  8209356 taaccgaattgacgaatgcgaggatcgttaggatcggtgatggagtgaaagagagaagctaaatcgatatt 8209426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 172 - 257
Target Start/End: Original strand, 42365183 - 42365268
Alignment:
Q  172 taaccgaattcaaggatgcgaagatccttaggatcggtgatggatttacagatagaagccaaatcgatattcacttcacttcgcac 257  Q
    |||||||||||| |||||||| | || |||||||||||||| || | ||||| |||||||| ||| |||||  ||||| |||||||    
T  42365183 taaccgaattcacggatgcgagggtctttaggatcggtgattgagtcacagagagaagccagatcaatattggcttcatttcgcac 42365268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University