View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11214_high_19 (Length: 218)

Name: NF11214_high_19
Description: NF11214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11214_high_19
NF11214_high_19
[»] chr4 (1 HSPs)
chr4 (4-121)||(37801703-37801818)


Alignment Details
Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 4 - 121
Target Start/End: Complemental strand, 37801818 - 37801703
Alignment:
Q  4 cccatgacagacaaaacaatgaaacaacatattcacataataaacttgatatataaaagattgccnnnnnnnnnnnnctttgatatttatataagatggg 103  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||            |||||||||||||||||||||||    
T  37801818 cccatgacagacaaaacaatgaaacaacatattcacataataaatttgatatataaaagattgcc--aaaaaaaaaactttgatatttatataagatggg 37801721  T
Q  104 ttatgcttgttaaagatt 121  Q
    ||||||||||||||||||    
T  37801720 ttatgcttgttaaagatt 37801703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University