View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1120_low_9 (Length: 326)

Name: NF1120_low_9
Description: NF1120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1120_low_9
NF1120_low_9
[»] chr4 (2 HSPs)
chr4 (153-311)||(52391502-52391654)
chr4 (29-68)||(52391206-52391245)


Alignment Details
Target: chr4 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 153 - 311
Target Start/End: Original strand, 52391502 - 52391654
Alignment:
Q  153 ttagcctccaatcatcattagtttttgtaatatcactaataagattccctcttcaagttggaacaggaattctgttccaattttgagagtttaaaaggta 252  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||| |||||||    
T  52391502 ttagcctccaatcatcattagtttttgtaatatcactaataagattccctcttcaagttggaacc------ctgttccaattttgagagtttgaaaggta 52391595  T
Q  253 tgagaagggatggcttcagaggtggaaaatataggagggaatgtggaaatcttgtacat 311  Q
    |||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||    
T  52391596 tgagaagggatgacttcagagttggaaaatataggagggaatgtggaaatcttgtacat 52391654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 29 - 68
Target Start/End: Original strand, 52391206 - 52391245
Alignment:
Q  29 aaaataatcatcatattacaaacatggataattttcttta 68  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  52391206 aaaataatcatcatattacaaacatggataattttcttta 52391245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University