View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11207_low_46 (Length: 253)

Name: NF11207_low_46
Description: NF11207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11207_low_46
NF11207_low_46
[»] chr4 (1 HSPs)
chr4 (38-253)||(52992886-52993096)


Alignment Details
Target: chr4 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 38 - 253
Target Start/End: Original strand, 52992886 - 52993096
Alignment:
Q  38 cgagttttatgagcaaaagcaacggtttttatttgaatctcaataaaattaacaatttgaaaattggtcaactagtaaaccaacttaagtagtatgaaat 137  Q
    ||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52992886 cgagttttatgagcaaacgcaacggcttttatttgaatctcaataaaattaacaatttgaaaattggtcaactagtaaaccaacttaagtagtatgaaat 52992985  T
Q  138 aataccctttcacatgtttgggaacaaaatagtactaaaacaatatattgtaaataaaatnnnnnnnttatagtattaagcaaatgaaattatacctgct 237  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||        |||||||||||||||||||||||||||||||||    
T  52992986 aataccctttcacatgtttgggaacaaaatagtactaaaacaatatatagtaaataaaa-----aaattatagtattaagcaaatgaaattatacctgct 52993080  T
Q  238 atgatgacaagaatgt 253  Q
    ||||||||||||||||    
T  52993081 atgatgacaagaatgt 52993096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University