View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11203_high_8 (Length: 307)

Name: NF11203_high_8
Description: NF11203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11203_high_8
NF11203_high_8
[»] chr7 (1 HSPs)
chr7 (1-291)||(46557315-46557608)


Alignment Details
Target: chr7 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 1 - 291
Target Start/End: Original strand, 46557315 - 46557608
Alignment:
Q  1 tagaagtagtaaaagagagttattaaaaccgcatgcagaggaatgaatgaatgtttgatttaccttgcacatgagaggttgtaattgttgttcttctggt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46557315 tagaagtagtaaaagagagttattaaaaccgcatgcagaggaatgaatgaatgtttgatttaccttgcacatgagaggttgtaattgttgttcttctggt 46557414  T
Q  101 ggtagaggtggtggtgcttcttgaacaactactagttcgggtcttgtttctgttgcttccattgggaagtgaaaagaaacaagagcgatgtttagaaaga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46557415 ggtagaggtggtggtgcttcttgaacaactactagttcgggtcttgtttctgttgcttccattgggaagtgaaaagaaacaagagcgatgtttagaaaga 46557514  T
Q  201 gaaagagaggaggttactaattaagaaca---aggctttaaggttaattttggtatataaaaggtgatcacgaagaagaatgggaggagaatat 291  Q
    |||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46557515 gaaagagaggaggttactaattaagaacaaggaggctttaaggttaattttggtatataaaaggtgatcacgaagaagaatgggaggagaatat 46557608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University