View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11201_low_49 (Length: 229)

Name: NF11201_low_49
Description: NF11201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11201_low_49
NF11201_low_49
[»] chr8 (2 HSPs)
chr8 (64-210)||(32241926-32242069)
chr8 (1-33)||(32241896-32241928)


Alignment Details
Target: chr8 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 64 - 210
Target Start/End: Original strand, 32241926 - 32242069
Alignment:
Q  64 aaaataaaaatatgatacaaaattaatggccatgagttgcttgctttatatgctaaagaactcgaaatgcttaaccacttaataattaccctccaaacac 163  Q
    ||||||||||||||||||||||||||||||||||||||   ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  32241926 aaaataaaaatatgatacaaaattaatggccatgagtt---tgctttatatgataaagaactcgaaatgcttaaccacttaataattaccctccaaacac 32242022  T
Q  164 taccaaaagttaatactttgtaatgcttaacctaaccacttaataat 210  Q
    ||||||||  ||||||||||||||||||||||||||||| |||||||    
T  32242023 taccaaaaactaatactttgtaatgcttaacctaaccacataataat 32242069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 32241896 - 32241928
Alignment:
Q  1 tcttttaaaattagtcaaatgttgccatccaaa 33  Q
    |||||||||||||||||||||||||| ||||||    
T  32241896 tcttttaaaattagtcaaatgttgccgtccaaa 32241928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University