View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1119_low_13 (Length: 324)

Name: NF1119_low_13
Description: NF1119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1119_low_13
NF1119_low_13
[»] chr3 (1 HSPs)
chr3 (16-324)||(47782441-47782750)


Alignment Details
Target: chr3 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 16 - 324
Target Start/End: Complemental strand, 47782750 - 47782441
Alignment:
Q  16 atcaaaggatatagcattacatatgggtgtcctagatatatgctatattctttccggccggtagcacacaacacttgcatcaaatttggtggcatcaaaa 115  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  47782750 atcaaaggatatagcattacatatggatgtcctagatatatgctatattctttccggccggtagcacacaacacttgcatcaaatttggtggcataaaaa 47782651  T
Q  116 atggtccatgcaaacaatagtcatatttggtggtatatttaccactttagctggaatgtcatattctcgtgtcctctttaattacttgaaactttgagcg 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47782650 atggtccatgcaaacaatagtcatatttggtggtatatttaccactttagctggaatgtcatattctcgtgtcctctttaattacttgaaactttgagcg 47782551  T
Q  216 ggtgctcaactttgcgtctggctcacaaagatagaaaattgcatttgcacc-nnnnnnngatagaaaatggattggactaaaatacgtcgcccattgccg 314  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||| | || |||    
T  47782550 ggtgctcaactttgcgtctggctcacaaagatagaaaattgcatttgcaccaaaaaaaagatagaaaatggattggactaaaatacgtcgctcgttaccg 47782451  T
Q  315 gaatagatct 324  Q
    ||||||||||    
T  47782450 gaatagatct 47782441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University