View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11184_low_3 (Length: 313)

Name: NF11184_low_3
Description: NF11184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11184_low_3
NF11184_low_3
[»] chr2 (1 HSPs)
chr2 (221-303)||(38932819-38932901)
[»] chr4 (1 HSPs)
chr4 (25-102)||(55827367-55827442)


Alignment Details
Target: chr2 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 221 - 303
Target Start/End: Original strand, 38932819 - 38932901
Alignment:
Q  221 tgcagaatgcgtgtttgcttgatcatcattaattaatgttttaaccaaataatctcacaagtcacaaatgtcatgcccctttg 303  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  38932819 tgcagaatgcatgtttgcttgatcatcattaattaatgttttaaccaaataatctcacaagtcactaatgtcatgcccctttg 38932901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 25 - 102
Target Start/End: Complemental strand, 55827442 - 55827367
Alignment:
Q  25 tccttatcttcgtagattggttagctataattatatcatatcttatgcatcaagtgaagcgcaaaaacaatagcaatt 102  Q
    ||||||| |||||||||||||||||||||||||    ||||||||||||||||  |||  |||||| |||||||||||    
T  55827442 tccttattttcgtagattggttagctataattactgtatatcttatgcatcaaaagaa--gcaaaagcaatagcaatt 55827367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University