View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11183_low_52 (Length: 236)

Name: NF11183_low_52
Description: NF11183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11183_low_52
NF11183_low_52
[»] chr7 (2 HSPs)
chr7 (99-223)||(44615436-44615560)
chr7 (1-37)||(44615643-44615679)
[»] chr1 (1 HSPs)
chr1 (99-160)||(39314798-39314859)


Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 99 - 223
Target Start/End: Complemental strand, 44615560 - 44615436
Alignment:
Q  99 gatgtaggagttattgctgctacgtttgtgtgtcctttagatgttatcaaaactaggtttcaagttggtgttccccagctcgctaatggaactgttaaag 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44615560 gatgtaggagttattgctgctacgtttgtgtgtcctttagatgttatcaaaactaggtttcaagttggtgttccccagctcgctaatggaactgttaaag 44615461  T
Q  199 gtaccatataacctgcccactcttc 223  Q
    |||||||||||||||||||||||||    
T  44615460 gtaccatataacctgcccactcttc 44615436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 44615679 - 44615643
Alignment:
Q  1 gtgcttccgctggtataccttcttttctcagctgccc 37  Q
    |||||||||||||||||||||||||||||||||||||    
T  44615679 gtgcttccgctggtataccttcttttctcagctgccc 44615643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 99 - 160
Target Start/End: Original strand, 39314798 - 39314859
Alignment:
Q  99 gatgtaggagttattgctgctacgtttgtgtgtcctttagatgttatcaaaactaggtttca 160  Q
    |||| ||||||||||||||||||||||||||||||||||||||| || ||||| ||||||||    
T  39314798 gatgcaggagttattgctgctacgtttgtgtgtcctttagatgtgattaaaaccaggtttca 39314859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University