View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11183_low_29 (Length: 308)

Name: NF11183_low_29
Description: NF11183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11183_low_29
NF11183_low_29
[»] chr7 (1 HSPs)
chr7 (12-244)||(5831399-5831620)


Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 12 - 244
Target Start/End: Complemental strand, 5831620 - 5831399
Alignment:
Q  12 atgaattacaaaacccatgtaatacaagacttactttcaatgtgatgtgagttacaatagaggaatcaaatatgaccctctccaccaataggtgaatatg 111  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  5831620 atgagttacaaaacccatgtaatacaagacttactttcaatgtgatgtgagttacaatagaggaatcaaatacgaccctctccaccaataggtgaatatg 5831521  T
Q  112 tgatgttttgtccccttcctaattggtatatattattttatactgcaaacatggagtgctatagaaaagttcccttgcgctttttgccatcgtggaagtg 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||           |||||||||||||||||||||||||||||||||||||    
T  5831520 tgatgttttgtccccttcctaattggtatatattattttatactgcaaacat-----------gaaaagttcccttgcgctttttgccatcgtggaagtg 5831432  T
Q  212 aatctatggcagagtcatccatgacgatgattt 244  Q
    |||||||||||||||||||||||||||||||||    
T  5831431 aatctatggcagagtcatccatgacgatgattt 5831399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University