View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11180A_low_78 (Length: 294)

Name: NF11180A_low_78
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11180A_low_78
NF11180A_low_78
[»] chr4 (1 HSPs)
chr4 (1-277)||(31441811-31442088)


Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 277
Target Start/End: Complemental strand, 31442088 - 31441811
Alignment:
Q  1 gatttaccgcaaccactgtgtcttgctagtgccaccgtttttccagcctcaactttgagattcaaaccctggaatacaatttgctcagttctagagggat 100  Q
    |||||||||||||||||||| | | | ||||||||||||  |||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||    
T  31442088 gatttaccgcaaccactgtgccctacaagtgccaccgttcgtccagcctcaactttgagattcaaaccctggaataccatttgctcaggtctagagggat 31441989  T
Q  101 aagcaaagaatacatttttaagctccaccctgccccttattttccnnnnnnn-atctgctccccataaggtttcaggatcaatctcacttttcctgtcta 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||    
T  31441988 aagcaaagaatacatttttaagctccaccctgccccttattttccttttttttatctgctccccataaggtttcaggatcaatctcacttttcctgtcta 31441889  T
Q  200 ggatagcgaaaactgatccaactgcattgcttcctttagatatgtcagaagtcatgcttccagcttctgcaatgatgt 277  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31441888 ggatagcgaaaactgatccaactgcattgcttcctttagatatgtcagaagtcatgcttccagcttctgcaatgatgt 31441811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University