View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11180A_low_191 (Length: 231)

Name: NF11180A_low_191
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11180A_low_191
NF11180A_low_191
[»] chr8 (1 HSPs)
chr8 (48-208)||(28586923-28587083)


Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 48 - 208
Target Start/End: Complemental strand, 28587083 - 28586923
Alignment:
Q  48 tgggaacatatggtaaacgtttaccttttcttgttaacttttctattttatataatatgattggatttagtgaaatgatagtatgagtgtatgacaccat 147  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  28587083 tgggaacatatggtaaacgtttacctattcttgttaacttttctattttataaaatatgattggatttagtgaaatgatagtatgagtgtatgacaccat 28586984  T
Q  148 tagctttaatctactcatatattttaccaatctccccatatattctgtatccatatatatt 208  Q
    || |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
T  28586983 taactttaatctactgatatattttaccaatctccccatatattctgtatccatatatatt 28586923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University