View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11180A_low_129 (Length: 252)

Name: NF11180A_low_129
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11180A_low_129
NF11180A_low_129
[»] chr6 (1 HSPs)
chr6 (1-227)||(23333765-23333991)


Alignment Details
Target: chr6 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 23333991 - 23333765
Alignment:
Q  1 ggtgggtaagattggaggtgggtggggtgctctttgcaaggcacggaggctgtaaccaaaacagccattgaagttgggtgtgactcatgacgcggacaat 100  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||    
T  23333991 ggtgtgtaagattggaggtgggtggggtgctctttgcaaggcacggaggctgcaaccaaaacagccattgaagttgggtgtgactcatgaagcggacaat 23333892  T
Q  101 aaggttgtctatctgaagcatgttccttttccatcaatgcagacggacataacgaagttgaccgataaaattgtgtgccagaatgcagctgaagcagtac 200  Q
    ||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
T  23333891 aaggttgtctatctgaagcatcttcgttttccatcaatgcagacggacataacgaagttgaccgataaaattgtgtgccggaatgcagctgaagcagtac 23333792  T
Q  201 tcccccaaagaggttgataagtttgtt 227  Q
    |||||| ||||||||||||||||||||    
T  23333791 tccccccaagaggttgataagtttgtt 23333765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University