View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1117_low_1 (Length: 522)

Name: NF1117_low_1
Description: NF1117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1117_low_1
NF1117_low_1
[»] chr3 (1 HSPs)
chr3 (318-513)||(14758536-14758721)
[»] chr1 (2 HSPs)
chr1 (89-160)||(3614430-3614504)
chr1 (314-370)||(3614739-3614793)


Alignment Details
Target: chr3 (Bit Score: 149; Significance: 2e-78; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 149; E-Value: 2e-78
Query Start/End: Original strand, 318 - 513
Target Start/End: Original strand, 14758536 - 14758721
Alignment:
Q  318 aagaaagtagagaaccattttgcttgactttctcgtttgctcttgtttcttcctttcccctacgcatgtgtagtggtttttggttgtctttggttgtttc 417  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||          ||||||||    
T  14758536 aagaaagtagagaaccattttgcttgactttctcgtttgctcttgtttcttcctttcccctaagcatgtgtggtggtttttg----------gttgtttc 14758625  T
Q  418 tttcagtactggaccatccatcttttttgatgaaaaatatagcccgtgttttaaagcgaaaatattaatttatactagtaatttgttttttctttt 513  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  14758626 tttcagtactggaccatccatcttttttgatgaaaaatatagcccgtgttttaaagcgaaaatgttaatttatactagtaatttgttttttctttt 14758721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.00000000001; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 89 - 160
Target Start/End: Original strand, 3614430 - 3614504
Alignment:
Q  89 atgagttttcatagtgtgaagagggaacatggaggag---taattaatttatggaccaataagtggaatagggac 160  Q
    ||||||||||||||||||||||||||| |||||| ||   |||||||||  |||||||| |||||||||| ||||    
T  3614430 atgagttttcatagtgtgaagagggaatatggagaagtaataattaattggtggaccaagaagtggaatatggac 3614504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 314 - 370
Target Start/End: Original strand, 3614739 - 3614793
Alignment:
Q  314 gatgaagaaagtagagaaccattttgcttgactttctcgtttgctcttgtttcttcc 370  Q
    ||||||||||||||| ||| |||   |||||||| ||||||||||||||||||||||    
T  3614739 gatgaagaaagtagaaaactatta--cttgacttgctcgtttgctcttgtttcttcc 3614793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University