View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11172_low_20 (Length: 219)

Name: NF11172_low_20
Description: NF11172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11172_low_20
NF11172_low_20
[»] chr1 (1 HSPs)
chr1 (1-199)||(50082335-50082534)


Alignment Details
Target: chr1 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 50082534 - 50082335
Alignment:
Q  1 ggtatgttaaataatagtatatattattatatgtatggaaatgagacattattttagagatatggtgaaagtgaagttgaaagcctggacctgtctacca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  50082534 ggtatgttaaataatagtatatattattatatgtatggaaatgagacattattttagagatatggtgaaagtgaagttgaaagcctggacctgtctacca 50082435  T
Q  101 aacttatcaagattaataaaaagatggcc--aagactagtaattaggtcggcaaacaaaagtagaaggaagccaaaacaaatatgactgaaattaataca 198  Q
    |||||||||||||||| ||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  50082434 aacttatcaagattaa-aaaaagatggccaaaagactagtaattaggtcggcaaacaaaagtagaaggaagccaaaacaaatatgactgaaattaataca 50082336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University