View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11171A_low_192 (Length: 241)

Name: NF11171A_low_192
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11171A_low_192
NF11171A_low_192
[»] chr3 (1 HSPs)
chr3 (1-152)||(25933262-25933416)


Alignment Details
Target: chr3 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 152
Target Start/End: Original strand, 25933262 - 25933416
Alignment:
Q  1 aatatccgtctcatagtcaaggagatggaataatgtttgattgttgtcgtttttattaaactaagttgaacgccctttctctaaaaatcagaaagttaac 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  25933262 aatatccgtctcatagtcaaggagatggaataatgtttgattgttgtcgtttttattaaactaagttgaacgccctttctctgaaaatcagaaagttaac 25933361  T
Q  101 atcaaaacacaataat---ggtttgttcttgaaaaatgattaatttaacatacaa 152  Q
    ||||||| ||||||||   ||||||||||||||||||||||||||||||||||||    
T  25933362 atcaaaatacaataattacggtttgttcttgaaaaatgattaatttaacatacaa 25933416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University