View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1116_low_9 (Length: 339)

Name: NF1116_low_9
Description: NF1116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1116_low_9
NF1116_low_9
[»] chr1 (2 HSPs)
chr1 (119-212)||(52483052-52483145)
chr1 (292-325)||(52482916-52482949)


Alignment Details
Target: chr1 (Bit Score: 90; Significance: 2e-43; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 119 - 212
Target Start/End: Complemental strand, 52483145 - 52483052
Alignment:
Q  119 cgcctctaaatccaacgatctcatctccctcgctcgccactatggaaactgctattcccaactctccaaagctcgtctcaggtgaacctttcac 212  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52483145 cgcctctaaatccaacgatctcatctctctcgctcgccactatggaaactgctattcccaactctccaaagctcgtctcaggtgaacctttcac 52483052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 292 - 325
Target Start/End: Complemental strand, 52482949 - 52482916
Alignment:
Q  292 gaaactaaattttagtttgctcgtggttgcaaca 325  Q
    ||||||||||| ||||||||||||||||||||||    
T  52482949 gaaactaaattgtagtttgctcgtggttgcaaca 52482916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University